ID: 1069270628_1069270631

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1069270628 1069270631
Species Human (GRCh38) Human (GRCh38)
Location 10:66522612-66522634 10:66522635-66522657
Sequence CCAGCCCTGTGGAGCTGTGGGTC AATTAAACCTCTTTCCTTTATGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 325, 3: 3685, 4: 7570} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!