ID: 1069323395_1069323397

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1069323395 1069323397
Species Human (GRCh38) Human (GRCh38)
Location 10:67201674-67201696 10:67201711-67201733
Sequence CCTAAATTATCAGGCTTTACTTT CCTCCATTTCACATGTTTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 370} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!