ID: 1069384958_1069384961

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1069384958 1069384961
Species Human (GRCh38) Human (GRCh38)
Location 10:67875816-67875838 10:67875832-67875854
Sequence CCAGTTGAGAACCACTGATCTAG GATCTAGGTTTATATACTGCTGG
Strand - +
Off-target summary {0: 4, 1: 46, 2: 199, 3: 497, 4: 987} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!