ID: 1069534822_1069534830

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1069534822 1069534830
Species Human (GRCh38) Human (GRCh38)
Location 10:69245411-69245433 10:69245456-69245478
Sequence CCTGTCTCTACGAAAATAAAAAA CCCCTATGGGAGGCTGAGGCAGG
Strand - +
Off-target summary {0: 4, 1: 437, 2: 12910, 3: 33020, 4: 273501} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!