ID: 1069546730_1069546738

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1069546730 1069546738
Species Human (GRCh38) Human (GRCh38)
Location 10:69334508-69334530 10:69334524-69334546
Sequence CCTTAAAGTGAGAGGCCGCTGCC CGCTGCCGGGGGAGAAGGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 26, 4: 366}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!