|
Left Crispr |
Right Crispr |
Crispr ID |
1069547800 |
1069547812 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
10:69341235-69341257
|
10:69341275-69341297
|
Sequence |
CCCTGCAACCTCTGCTTCCCCAG |
CCTCAGTCTCCCGAGTAGCTGGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 9, 2: 71, 3: 651, 4: 2019} |
{0: 3228, 1: 113305, 2: 296144, 3: 221452, 4: 120028} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|