ID: 1069547800_1069547812

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1069547800 1069547812
Species Human (GRCh38) Human (GRCh38)
Location 10:69341235-69341257 10:69341275-69341297
Sequence CCCTGCAACCTCTGCTTCCCCAG CCTCAGTCTCCCGAGTAGCTGGG
Strand - +
Off-target summary {0: 2, 1: 9, 2: 71, 3: 651, 4: 2019} {0: 3228, 1: 113305, 2: 296144, 3: 221452, 4: 120028}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!