ID: 1069547800_1069547815

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1069547800 1069547815
Species Human (GRCh38) Human (GRCh38)
Location 10:69341235-69341257 10:69341284-69341306
Sequence CCCTGCAACCTCTGCTTCCCCAG CCCGAGTAGCTGGGACTACAGGG
Strand - +
Off-target summary {0: 2, 1: 9, 2: 71, 3: 651, 4: 2019} {0: 660, 1: 2676, 2: 4545, 3: 3877, 4: 3084}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!