ID: 1069547806_1069547812

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1069547806 1069547812
Species Human (GRCh38) Human (GRCh38)
Location 10:69341254-69341276 10:69341275-69341297
Sequence CCAGCTCAGGCAATCCTCCCGCC CCTCAGTCTCCCGAGTAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 34, 2: 226, 3: 830, 4: 2971} {0: 3228, 1: 113305, 2: 296144, 3: 221452, 4: 120028}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!