ID: 1069550440_1069550450

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1069550440 1069550450
Species Human (GRCh38) Human (GRCh38)
Location 10:69360435-69360457 10:69360463-69360485
Sequence CCCACTTACTGGAGGCCCCGGCC GGGTATGGCTGTGGCCTTGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 80} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!