ID: 1069629072_1069629076

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1069629072 1069629076
Species Human (GRCh38) Human (GRCh38)
Location 10:69886893-69886915 10:69886926-69886948
Sequence CCACAAAGATTAGGGGATGCTCA AACTGCTAGGAGAAGCCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 96} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!