ID: 1069672507_1069672510

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1069672507 1069672510
Species Human (GRCh38) Human (GRCh38)
Location 10:70220218-70220240 10:70220257-70220279
Sequence CCGCACCTGGCCTGCAATTATGC TTTTTTTTTTTTTTGAGACAAGG
Strand - +
Off-target summary No data {0: 13494, 1: 16907, 2: 33917, 3: 145359, 4: 149502}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!