ID: 1069685115_1069685130

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1069685115 1069685130
Species Human (GRCh38) Human (GRCh38)
Location 10:70312962-70312984 10:70313006-70313028
Sequence CCTTTGGCTTTCATTCCTCCTCT GGGTGGGCTAATGGGCATTGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 60, 4: 539} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!