ID: 1069689758_1069689766

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1069689758 1069689766
Species Human (GRCh38) Human (GRCh38)
Location 10:70342557-70342579 10:70342599-70342621
Sequence CCTGAGCCTCAGTTTCCTCATCC AGCTGCCTAGCAGAGCTGTTGGG
Strand - +
Off-target summary {0: 7, 1: 123, 2: 745, 3: 1942, 4: 3908} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!