ID: 1069827392_1069827395

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1069827392 1069827395
Species Human (GRCh38) Human (GRCh38)
Location 10:71262490-71262512 10:71262504-71262526
Sequence CCTTGGGGAGAACAGGACCCAGA GGACCCAGAGGAGCCCGCCCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 41, 4: 308} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!