ID: 1070373830_1070373833

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1070373830 1070373833
Species Human (GRCh38) Human (GRCh38)
Location 10:75810077-75810099 10:75810097-75810119
Sequence CCAGGTGGACGAAACAGCATGAG GAGCAGAGTCTCTGGCAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 48, 4: 311} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!