ID: 1070499904_1070499907

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1070499904 1070499907
Species Human (GRCh38) Human (GRCh38)
Location 10:77062940-77062962 10:77062967-77062989
Sequence CCATGCAACCAGAAGTCATCTTC TTCCTCCTCCCAAAGAGCTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 216} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!