ID: 1070605961_1070605978

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1070605961 1070605978
Species Human (GRCh38) Human (GRCh38)
Location 10:77898719-77898741 10:77898770-77898792
Sequence CCCCCTCCATGGCCTGGCTCCTG GGCAGGCGGTAAGGAAGTAGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 11, 3: 86, 4: 699} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!