ID: 1070605963_1070605978

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1070605963 1070605978
Species Human (GRCh38) Human (GRCh38)
Location 10:77898721-77898743 10:77898770-77898792
Sequence CCCTCCATGGCCTGGCTCCTGAC GGCAGGCGGTAAGGAAGTAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 51, 4: 440} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!