ID: 1070605964_1070605978

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1070605964 1070605978
Species Human (GRCh38) Human (GRCh38)
Location 10:77898722-77898744 10:77898770-77898792
Sequence CCTCCATGGCCTGGCTCCTGACA GGCAGGCGGTAAGGAAGTAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 368} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!