ID: 1070676826_1070676833 |
View in Genome Browser |
Spacer: 13 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1070676826 | 1070676833 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 10:78417674-78417696 | 10:78417710-78417732 |
Sequence | CCCAGTGGTGGCAAGTCCTTGTC | AGCTGAGTCCAGTGGTCACTGGG |
Strand | - | + |
Off-target summary | No data | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |