ID: 1070790427_1070790433

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1070790427 1070790433
Species Human (GRCh38) Human (GRCh38)
Location 10:79186041-79186063 10:79186067-79186089
Sequence CCAGTGTTCACTTTCAGGTCCCT TGTTTTTGAGGGCACTGTAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 197} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!