ID: 1070830566_1070830575

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1070830566 1070830575
Species Human (GRCh38) Human (GRCh38)
Location 10:79415630-79415652 10:79415656-79415678
Sequence CCTCCCTGCACCCTCTCCCAGGT AAAGGCCTTGTTGATTCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 79, 4: 732} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!