ID: 1070935551_1070935557

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1070935551 1070935557
Species Human (GRCh38) Human (GRCh38)
Location 10:80291982-80292004 10:80292023-80292045
Sequence CCTTATGTTTTTTTATTGGGGGG TCACCCAGGCTGGAGTGCAATGG
Strand - +
Off-target summary No data {0: 14249, 1: 108577, 2: 215203, 3: 218267, 4: 141562}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!