ID: 1071128536_1071128543

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1071128536 1071128543
Species Human (GRCh38) Human (GRCh38)
Location 10:82364846-82364868 10:82364897-82364919
Sequence CCATTGCCCAGGGTGATACTTTG TCTGACATGCTGATAGGAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 110} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!