ID: 1071147958_1071147967

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1071147958 1071147967
Species Human (GRCh38) Human (GRCh38)
Location 10:82597475-82597497 10:82597510-82597532
Sequence CCTACAAATTACATACATACAGG GGTGAATTAGAAGCAGGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 21, 4: 185} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!