ID: 1071503516_1071503522

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1071503516 1071503522
Species Human (GRCh38) Human (GRCh38)
Location 10:86219543-86219565 10:86219567-86219589
Sequence CCGCTCCCCTTCTCCCTGCTCTG ACACTACTCCCCTACAGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 19, 3: 250, 4: 2045} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!