ID: 1071542238_1071542242

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1071542238 1071542242
Species Human (GRCh38) Human (GRCh38)
Location 10:86496538-86496560 10:86496560-86496582
Sequence CCAAGTGTCCATCAACAGATGAA ATGGATAAACAAAATGTGGAAGG
Strand - +
Off-target summary {0: 109, 1: 466, 2: 1275, 3: 2600, 4: 3918} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!