ID: 1071573044_1071573054

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1071573044 1071573054
Species Human (GRCh38) Human (GRCh38)
Location 10:86708424-86708446 10:86708461-86708483
Sequence CCATAAGCCTCTGCTCCCTTTCC GACTCAGGACCTGTAGCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 428} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!