ID: 1071592739_1071592749

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1071592739 1071592749
Species Human (GRCh38) Human (GRCh38)
Location 10:86891119-86891141 10:86891162-86891184
Sequence CCTGCATGACGGTCATCGTGTCT TGGTGGTGGTGGGCTCTGCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 25} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!