ID: 1071611147_1071611152

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1071611147 1071611152
Species Human (GRCh38) Human (GRCh38)
Location 10:87032298-87032320 10:87032342-87032364
Sequence CCTGTTTTTTTTTTCTTTTCTTT TTTCTCCCCCACCACAGTGTGGG
Strand - +
Off-target summary {0: 7, 1: 121, 2: 2523, 3: 39719, 4: 59781} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!