ID: 1071612848_1071612858

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1071612848 1071612858
Species Human (GRCh38) Human (GRCh38)
Location 10:87047326-87047348 10:87047366-87047388
Sequence CCTCCTGCCTCAGCCTTCTGAGT TATACTACCACAACTGGCTGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!