ID: 1071612853_1071612858

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1071612853 1071612858
Species Human (GRCh38) Human (GRCh38)
Location 10:87047339-87047361 10:87047366-87047388
Sequence CCTTCTGAGTAGCTGGGACCATA TATACTACCACAACTGGCTGTGG
Strand - +
Off-target summary {0: 26, 1: 838, 2: 12094, 3: 73277, 4: 195843} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!