ID: 1071784777_1071784778

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1071784777 1071784778
Species Human (GRCh38) Human (GRCh38)
Location 10:88886933-88886955 10:88886955-88886977
Sequence CCTGTCACTACAACTGTATCATT TTAACACTAGAAATACAGAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 22, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!