ID: 1071822541_1071822549

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1071822541 1071822549
Species Human (GRCh38) Human (GRCh38)
Location 10:89293047-89293069 10:89293063-89293085
Sequence CCCCATAATCCTCATGTGTCAAG TGTCAAGGGCAGGACCTGATGGG
Strand - +
Off-target summary No data {0: 1, 1: 9, 2: 62, 3: 493, 4: 1628}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!