ID: 1071835725_1071835734

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1071835725 1071835734
Species Human (GRCh38) Human (GRCh38)
Location 10:89415188-89415210 10:89415229-89415251
Sequence CCCGACGGCTCTTCTCGGCAGCG GGTCCGCGGCCGCCGCCTCCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 68, 4: 368}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!