ID: 1071835732_1071835736

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1071835732 1071835736
Species Human (GRCh38) Human (GRCh38)
Location 10:89415221-89415243 10:89415236-89415258
Sequence CCGTGCTGGGTCCGCGGCCGCCG GGCCGCCGCCTCCGGGAAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 119} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!