ID: 1071923156_1071923159

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1071923156 1071923159
Species Human (GRCh38) Human (GRCh38)
Location 10:90374390-90374412 10:90374411-90374433
Sequence CCAGGTCAGCCAGGCTCATTGTG TGCTCATTGAAGCCATCCTTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!