ID: 1072025888_1072025894

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1072025888 1072025894
Species Human (GRCh38) Human (GRCh38)
Location 10:91456096-91456118 10:91456113-91456135
Sequence CCAATTCTGTGAAGAAAGCCATT GCCATTGGTAGCCTGATGGGGGG
Strand - +
Off-target summary {0: 81, 1: 10499, 2: 3869, 3: 1301, 4: 733} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!