ID: 1072025898_1072025899

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1072025898 1072025899
Species Human (GRCh38) Human (GRCh38)
Location 10:91456124-91456146 10:91456141-91456163
Sequence CCTGATGGGGGGGTGGCATTGAA ATTGAATCTATAAATTAACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 127} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!