ID: 1072290491_1072290500

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1072290491 1072290500
Species Human (GRCh38) Human (GRCh38)
Location 10:93960437-93960459 10:93960470-93960492
Sequence CCGTCGAGCCTCTCCCTGGATGG TGTGGAATACAGAGCCTTTTGGG
Strand - +
Off-target summary No data {0: 3, 1: 1, 2: 2, 3: 16, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!