ID: 1072525343_1072525349

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1072525343 1072525349
Species Human (GRCh38) Human (GRCh38)
Location 10:96266410-96266432 10:96266450-96266472
Sequence CCTCGGACATGTGGACTCTGGTT AGCCATGCCCAGAGTGGGTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 43, 4: 326}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!