ID: 1072591475_1072591490

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1072591475 1072591490
Species Human (GRCh38) Human (GRCh38)
Location 10:96832219-96832241 10:96832261-96832283
Sequence CCGCGGGTGCGTGCGCGGCCCCG CGCGGGGCCGCGGCGGAGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 17, 3: 133, 4: 881}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!