ID: 1072664636_1072664648

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1072664636 1072664648
Species Human (GRCh38) Human (GRCh38)
Location 10:97384517-97384539 10:97384566-97384588
Sequence CCATAACCTCAGCAGCCAGGATG CTGCCTGGACGGAGACCCTGAGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 5, 3: 21, 4: 234} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!