ID: 1072697406_1072697415

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1072697406 1072697415
Species Human (GRCh38) Human (GRCh38)
Location 10:97614073-97614095 10:97614120-97614142
Sequence CCCTGAGCCTCATCTGTAATACA AACAAGGACGTGCATGTAAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 19, 4: 155} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!