ID: 1072697410_1072697415

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1072697410 1072697415
Species Human (GRCh38) Human (GRCh38)
Location 10:97614080-97614102 10:97614120-97614142
Sequence CCTCATCTGTAATACAGGGATAA AACAAGGACGTGCATGTAAAAGG
Strand - +
Off-target summary {0: 1, 1: 32, 2: 192, 3: 1159, 4: 3852} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!