ID: 1072780994_1072780998

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1072780994 1072780998
Species Human (GRCh38) Human (GRCh38)
Location 10:98251702-98251724 10:98251733-98251755
Sequence CCTGTAAGGAAGGGGACAGACAG GCAGGACGAAGCACTCTGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 217} {0: 1, 1: 0, 2: 1, 3: 12, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!