ID: 1072785036_1072785054

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1072785036 1072785054
Species Human (GRCh38) Human (GRCh38)
Location 10:98273562-98273584 10:98273610-98273632
Sequence CCCTCTTCCCCCTGCACCCCCAG CTGTCTCAGCAGCTGGACACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 115, 4: 1115} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!