ID: 1072798080_1072798085

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1072798080 1072798085
Species Human (GRCh38) Human (GRCh38)
Location 10:98371961-98371983 10:98371989-98372011
Sequence CCACACTCGAGGTGTTAGGAGAG CTTCCTCTGAAACCTCCTGGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!