ID: 1073208252_1073208259

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1073208252 1073208259
Species Human (GRCh38) Human (GRCh38)
Location 10:101779978-101780000 10:101779992-101780014
Sequence CCCCGGCCCCACGGCGCCCGCCC CGCCCGCCCGGAGCCTCTAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 76, 4: 777} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!