ID: 1073252036_1073252041

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1073252036 1073252041
Species Human (GRCh38) Human (GRCh38)
Location 10:102126411-102126433 10:102126461-102126483
Sequence CCTCCAGCATCTAACAGAGTACC TTTTTTTTTTTTTTTTGAGATGG
Strand - +
Off-target summary No data {0: 83672, 1: 60776, 2: 74199, 3: 114646, 4: 163091}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!